Scientific Program

Day 1 :

Keynote Forum

Somil Singhal

Rajiv Gandhi University of Health Sciences

Keynote: Clinico haematological profile of hypochromic anemia in adults of age group 18-59 years of age: An observational study

Time : 10:00

Biography:

Dr. Somil Singhal has completed his Bachelor Of Medicine and Surgery ( MBBS) at the age of 25 years of age from Beijing Medical University, China and Post Doctoral Studies in Doctor Of Medicine In Pathology from Rajiv Gandhi University Of Health Sciences, Bangalore, India. Currently he is working as Senior Consultant Pathologist in the Pathology Departrment at Kriti Scanning and diagnostic center, Allahabad, India. He has attended various Conferences, CME’s and published Case studies , Dessertation in reputed journals like IJLSSR, Index Copernicus, Poland Journal Of Dermatology and is the life member of Indian Medical Association and Allahabad Medical Association. Besides this he had worked as a Ex. resident in AIIMS Trauma Center in the department of emergency medicine, Ex. Cardiac resident at Fortis Hospital Okhla, Delhi , E. Senior Resident in ARMC Solapur , Maharashtra, Ex. Senior Resident in Maharaja Agrasen Gruop Of hospitals , New Delhi, India and besides this attended various ITO and blood bank camps for service to the society.

Abstract:

Background: Hypochromic anemia in adults is a complex problem owing to variations in various haematological parameters. many studies in india and abroad had evaluated the causes and its appropriateness. in spite of this , there is diagnostic dilemma in diagnosing the appropriate cause of hypochromic anemia‟s. hence, this necessity need to take up the study on haematological profile on hypochromic anemia.

Objectives: The aim of the study was to perform haematological investigations required for diagnosing hypochromic anemia, to estimate the iron status of bone marrow aspirations and to assess which type of haemoglobin is responsible for causing hypochromic anemia by using haemoglobin electrophoresis.

Methods: 100 cases diagnosed with hypochromic anemia on peripheral blood smear were evaluated during one and half year study at department of pathology, s. nijalingappa medical college and hsk hospital, bagalkot, karnataka. other relevant investigations like bone marrow aspiration study, bone marrow biopsy, biochemical investigations were performed. conditions associated with hypochromic anemia were studied and categorized. haemoglobin electrophoresis was performed to evaluate the cause of hypochromic anemia.

Results: Majority of cases were females as compared to males in a age group of 18 – 38 years of age with most common sign and symptom being pallor followed by fever and anorexia. the most common category of diagnosis among these cases was inadequate dietary intake and infections. 61 % cases showed lymphocytosis followed by neutrophilia and eosinophilia. the most frequent peripheral blood smear picture was dimorphic type in 39 % cases followed by pancytopenia in 33 % cases. bone marrow iron grade being 3 + in 41 % cases. haemoglobin electrophoresis showed hba2 > 3.5 % in 2 % cases suggestive of beta thalassemia trait.

Conclusion: Correlation of morphology of peripheral blood smear , bone marrow aspiration, biopsy with rbcs indices and special techniques ; complete iron profile along with serum ferritin levels and hb electrophoresis proved highly valuable in distinguishing the various sub types of hypochromic anemia.

Session Introduction

Emily Bryer

University of Pennsylvania School of Medicine

Title: The heart of the matter: A unique convergence of cardiac neoplasm, hereditary nonpolyposis colorectal cancer, and spindle cell sarcoma
Speaker
Biography:

Dr. Emily Bryer is a physician in Philadelphia, Pennsylvania USA. She attended the Schreyer Honors College of The Pennsylvania State University for her undergraduate training where she served as President of Global Medical Brigades and established medical clinics in areas of Ghana, Honduras, Nicaragua, and Panama with
limited access to medical care and healthcare resources. She received her medical degree from The Philadelphia College of Osteopathic Medicine before starting her Internal Medicine residency at Pennsylvania Hospital of the University of Pennsylvania. Her research interests include venous thromboembolism in chemotherapy-induced anemia and gestational trophoblastic disease.

Abstract:

Primary cardiac tumors are exceedingly unusual and aggressive; they often develop in younger patients and present with advanced disease. The rarity and heterogeneity of primary cardiac tumors challenge the standardization of therapeutic guidelines. Undifferentiated primary cardiac spindle cell sarcomas, a distinct subset of primary cardiac sarcomas, are especially unique with fewer than 20 cases reported worldwide—the majority of which are of left atrial origin. We present a review of the etiology, pathophysiology, and therapy of undifferentiated primary cardiac spindle cell sarcomas. In conjunction, we present a unique case of a woman with Hereditary Nonpolyposis Colorectal Cancer (Lynch Syndrome) who presented with a primary cardiac spindle cell sarcoma of left ventricular origin, the first case of this type and location of cardiac tumor reported in a patient with Lynch Syndrome. While some malignancies are more common in patients with Lynch Syndrome, sarcomas are not one of them. The absence of metastases at the time of diagnosis is atypical for left-sided cardiac sarcomas, the overwhelming majority of which have metastases at the time of diagnosis. In addition to anatomic and pathophysiologic distinctions of this case from other primary cardiac spindle cell sarcomas, it also demonstrated unique immunohistochemistry as the first reported case of MDM-negative (murine double minute homolog, a principle diagnostic marker of spindle cell sarcoma) ever reported.

Katie Liston

University College Cork School of Medicine

Title: A retrospective lab-based analysis of errors contributing to rejected haematology and blood transfusion samples in Cork University Hospital with comparative study in University Hospital Kerry
Speaker
Biography:

Dr.Katie Liston is currently working as a doctor in Cork University Hospital after completing her graduation.

Abstract:

Aim: To retrospectively categorise features of individual WBIT errors in two types of laboratories and compare and contrast findings across two Irish hospitals.

Methods: Records of WBIT error were retrieved from CUH and UHK laboratories using Q-Pulse, APEX and hard copy surveys. All records of WBIT error in 2015/2016 were included. Each record was examined to determine date, location, grade of staff and discovery. Research was conducted with the support of University College Cork Medical School.

Results: 211 errors were identified. Identified rates of error were 3 times higher in CUH versus UHK (9/100,000 samples and 3/100,000 samples respectively) Transfusion error rates were higher than Haematology error rates in both hospitals. Haematology samples are labelled electronically in CUH and hand-written in UHK, however no significant difference between the two types of sample existed (p=0.2). Location differences between the two hospitals were significant for GP errors (p=0.03) and Maternity errors (p=0.03) with greater numbers of error seen in CUH for both. Early Discovery showed a significant difference (p=0.02) as did Late Discovery (p=0.018).

Conclusion: Distinct differences between rates and features of error exist between CUH and UHK. Similarities include higher proportions of Transfusion error in both. Case ascertainment differed between Transfusion and Haematology due to method of recording. Further investigation into these findings is warranted.

Samantha Bruno

University of Bologna

Title: Two novel DNMT3A mutations in acute myeloid leukemia
Speaker
Biography:

Dr. Samantha Bruno is a PhD student in hematology on university of Bologna. She has her expertise in molecular and cellular biology. Her research is mainly focused on molecular characterization of acute myeloid leukemia primary sample and in vitro study in order to identify new drugs for personalized therapy of acute myeloid leukemia patients.

 

Abstract:

Recurrent somatic mutations of DNMT3A occur in about 20% of acute myeloid leukemia (AML) patients, targeting a hot spot site at R882 codon [1]. DNMT3A mutations in primary AML samples are often heterozygous and are associated with CpG hypomethylation [2], which result in high myeloblast counts, and poor prognosis [3]. The study aims to characterize two new mutations in the DNMT3A gene, identified in two AML patients. Methodology & Theoretical Orientation: DNA was extracted from  mononucleated cells and it was sequenced by Sanger Sequencing and Next-Generation sequencing. Sequences obtained were mapped to human reference genome GRCh37/hg19 and annotated using Ion Reporter 5.10.2.0. The MethylFlash Methylated DNA Quantification Kit was used to detect CpG methylation status. DNMT3A protein level was assessed by western blot. Findings: Patient #1 had 70% of blasts in the BM at diagnosis and showed an undescribed single nucleotide variant of DNMT3A at exon 20 causing a premature STOP codon (cDNA c.2385G>A; tgG/tgA p.Trp795*; NM_022552;), coupled with IDH2 R172K mutation. The DNMT3A mutation load increased from 4% in the diagnosis sample to 38.2% in the follow-up, which had stable disease, evaluated 4 month after treatment in multicentric clinical trial. The increase of mutation rate correlated with DNA hypo-methylation and lead to loss of protein expression. Patient #2 had 80% of blasts in the BM at diagnosis and 90% at relapse, with a new insertion of 36 nucleotides in exon 22 of the DNMT3A gene (c.2924_2925ins36: TCATGAATGAGAAAGAGGACATCTTATGGTGCACT), along with FLT3-ITD. DNMT3A mutation load was 27.5% at diagnosis and increased at 48% at relapse, which occurred 7 month after completion of chemotherapy treatment. We did not observe a significant variation of protein levels, neither of DNA methylation. Conclusion & Significance: Obtained data support the hypothesis that DNMT3A mutations may be involved in pre-leukemic clonal hematopoietic expansion.

Janette Bester

University of Pretoria

Title: The link between breast cancer and hypercoagulability
Speaker
Biography:

Dr Bester has been establishing her research group as well as her research focus since 2015. Her research focusses mainly focus on vascular complications, specifically hemorhology in chronic inflammatory diseases such as Type 2 Diabetes, breast cancer and prostate cancer patients. She uses novel techniques that distinguishes her from most of the research in her field. Her goal with her research is to improve tissue perfusion to improve wound healing as well as quality of life in patients with vascular complications as well as to determine the thrombotic risk in a specific patient population.

Abstract:

Breast cancer patients are at an increased risk for thrombotic events such as deep vein thrombosis (DVT) and venous thromboembolism (VTE), drastically affecting survival and quality of life post-treatment for these patients. It has been proposed that this increased risk is caused by cancer associated inflammation-induced hypercoagulation, a key factor involved in thrombus formation. Methodology & Theoretical Orientation: This study utilized microscopy and rheological techniques to examine coagulation components during clot formation, in order to obtain a better understanding of how changes to these components may increase thrombus formation and thus the risk of thrombotic events. Whole blood from treatment-naïve breast cancer patients were compared to whole blood from healthy controls. Routine clinical tests were used to obtain an overall clinical picture of each participant. Scanning electron microscopy was used to study the fine ultrastructure of the red blood cells and platelets. Thromboelastography (TEG) was used to study the changes in clot dynamics during coagulation. Findings: SEM showed platelets to be activated as well as a presence of spontaneous fibrin fibre formation. Also, red blood cells from the patient group showed more irregular surface membranes, increased agglutination and eryptosis when compared to healthy controls. Results from the TEG showed that clots form faster in breast cancer patients, with increased strength and rigidity, thus revealing the hypercoagulable nature of whole blood in this patient group. The results in this study have revealed the marked differences in coagulation and associated blood components between healthy controls and treatment-naïve breast cancer patients. Conclusion & Significance: They provide a greater understanding of clot formation dynamics and has shown that even in a small sample size, breast cancer patients are at an increased risk of thrombotic events, traceable through rheological techniques. This justifies further investigation into the utilization of these techniques in a clinical, point-of-care setting, in order to increase the chance of survival and quality of life for these patient’s post-treatment.

Petra Matulova

University of Ostrava

Title: Frequency of sequence variants BRCA1, BRCA 2 and candidate genes in the Czech Republic
Speaker
Biography:

Petra Matulová is a PhD student in Public Health at the Department of Epidemiology and Public Health, Faculty of Medicine, Ostrava. She studies the prevention of individual diseases and also deals with the early diagnosis of cancer. She worked in the Laboratory of Molecular Biology, Department of Medical Genetics and now she is a member of the team at the Center of Epidemiology Research, Faculty of Medicine, Ostrava. She finds that genetics plays an increasingly important role in the development and progression of various cancers.  She deals with the issue of cancer also.

Abstract:

Breast cancer (BC) is one of the most discussed topics and it´s the most common cancers in women. BC are diagnosed over 6500 new cases for year in the Czech Republic. Risk factors include hormonal, nutritional, environmental and genetic factors. Genes play an important role in BC diagnosis are BRCA1/2 genes. In the Czech statistics, the lifetime cumulative risk of BC with confirmed mutations in BRCA1/2 genes ranges from 55 to 85%. The aim was to determine the presence of a pathogenic sequence variant in the BRCA1/BRCA2 genes, the frequency of mutation and finding the percentage of sick women and presence of mutation based on molecular genetic analysis. Methods: 2033 probands were genetically tested for the presence of sequence variants in BRCA1/BRCA2 genes. Of these, 157 women already had BC, 26 women had ovarian cancer and 22 probands was healthy at the time. Results: From genetically tested probands were confirmed 199 mutations in BRCA1/2 genes and 13 mutations in candidate genes. This confirms 9.8% of high risk persons or already cancer patients are hereditary by mutation in the BRCA1/BRCA2 gene. The BRCA1/2 gene mutations were compared in the Czech population and a higher quantity was find in the BRCA1 gene variants. The most frequent sequence variant is c.5266dupC in the BRCA1 gene. Conclusion: The results show 72% of women with confirmed BRCA1 mutation had BC and 16.4% had ovarian cancer. And women with confirmed mutations in the BRCA2 gene, 77.5% had breast cancer and 7% had ovarian cancer. Compared to Western European countries, the result is similar. The frequency of mutations in the BRCA1/BRCA2 genes is higher in the Czech Republic than the Eastern continent, as is the quantity of female BC patients. We should thing the causes and needs of investigating women with BC predisposition.

Md. Babu Mia

Bangladesh Institute of Child Health(BICH) & Dhaka Shishu (Children) Hospital

Title: Role of RBC indices in screening of thalassaemia and other haemoglobinopathies in children
Speaker
Biography:

Md.Babu Mia is currently working in Bangladesh Institute of Child Health(BICH) & Dhaka Shishu (Children) Hospital.

Abstract:

Background: Thalassaemia and haemoglobinopathies are common genetic disorders in Bangladesh. There are expensive tests to diagnose thalassaemia and haemoglobinopathies which are not affordable by majority of our patients. As cell counter is now widely available this study was undertaken to see the role of RBC indices in suggesting thalassaemia and advising further confirmatory tests like High Performance Liquid Chromatography (HPLC) or haemoglobin electrophoresis.

Objective: To observe values of RBC indices as tools for screening of thalassaemia and haemoglobinopathies.

Methodology: The retrospective study was carried out in Dhaka Shishu (Children) Hospital from November 2011 to November 2013. From the register, 555 subjects were taken as the study population. The study population were diagnosed as Beta thalassaemia major, Haemoglobin E beta thalassaemia, beta thalassaemia trait, haemoglobin E trait, haemoglobin E disease and normal haemoglobin status by HPLC. Their RBC indices were also taken from the register. Data were analyzed by SPSS (version 11.5). Mean values of RBC indices were expressed in different age groups against the diagnosis. Independent sample ‘t’ test was done to show the difference of mean values of RBC indices between the Normal haemoglobin status and thalassaemia or haemoglobinopathies.

Result: Mean values of RDW was markedly raised in both beta thalassaemia major and haemoglobin E beta thalassaemia with low mean values of RBC count, MCV and MCH. Mean values of RBC count were significantly high in both beta thalassaemia trait and haemoglobin E trait when compared with control, though mean values of MCV and MCH were low in these groups but not statistically significant when compared with the control.

Conclusion: Simple observation of RBC indices can be utilized to screen thalassaemia and haemaglobinopathies. HPLC should be advised for confirmation. Key words: RBC indices, Thalassaemia, haemoglobinopathies, HPLC.

Kristine Anne B. Monte

Cardinal Santos Medical Center

Title: Gastrointestinal stromal tumor presenting as lung mass: A case report
Speaker
Biography:

Kristine Anne B. Monte has completed her medical degree from Saint Louis University, Baguio City and took her medical internship at Philippine General Hospital, Manila. She is a 2nd year Internal Medicine Resident at Cardinal Santos Medical Center.

 

Abstract:

Gastrointestinal stromal tumors (GISTs) are rare neoplasms of the gastrointestinal tract commonly seen in middle-aged and elderly adults with the most common location in the stomach and small intestine. These tumors most frequently metastasize to the liver and peritoneum and it is relatively rare that the tumor invades the lung and the bones. GISTs outside the gastrointestinal tract appear to relapse more frequently. The treatment of unresectable GISTs is systemic treatment with tyrosine kinase inhibitors. We present a case of a 20-year-old Filipino male with a 2-week history of exertional dyspnea which on work up showed a left pulmonary mass consistent with a high grade gastrointestinal stromal tumor with no evidence of intra-abdominal GIST on work-up. Immunohistochemistry revealed spindle cells positive for CD 117, DOG-1, and CD 56, negative for CK, TTF-1, SMA, desmin, S-100, and CD34. He underwent attempted video-assisted thoracoscopic surgery (VATS), open thoracotomy, lung mass biopsy, tumor debulking and decortication and began treatment with oral imatinib mesylate (Gleevec) at a dose of 400mg/day but was refractory after 3 months of treatment. The patient had pulmonary infection and evidence of tumor progression at that time. He then underwent radiotherapy and a second line pazopanib 400mg/day was started.  Partial response was achieved after two to three months. The patient is currently stable and with good functional capacity.

Ahmed Elhussein

Children Cancer Hospital

Title: Role of FDG-PET/CT in the management of pediatric burkitt lymphoma
Speaker
Biography:

Dr Ahmed Elhussein is associate consultant of pediatric oncology in 57357 Children’s cancer hospital Egypt and an MD holder with a thesis under the title of “role of PET CT in pediatric non Hodgkin lymphoma”. I’m also part of my hospital’s study team in Hodgkin and non Hodgkin lymphoma. I'm highly interested in the field of PET/CT in lymphoma especially pediatric non Hodgkin lymphoma.

Abstract:

Background: Burkitt lymphoma (BL) is highly FDG-avid even though its usefulness in the management of pediatric patients with BL is still controversial.

Objectives: We analyzed the role of positron emission tomography/computerized tomography (PET/CT) in staging and evaluation of tumor response in newly diagnosed children with BL receiving LMB 96 protocol.

Design/Method: A total of 180 PET/CTs were performed in 94 patients (94 at diagnosis and 91 at time of evaluation). Involved areas were prospectively compared with those observed in contrast enhanced CT. Residual lesions in both PET/CT and contrast-enhanced CT were correlated with patient outcome at one year after end of treatment.

Results: A total of 199 disease sites were detected at PET/CT, while 172 sites were detected at contrast-enhanced CT and bone marrow biopsy (BMB). PET/CT showed improved detection of nodal lesions (P <0.0001) (Kappa value = 0.633), extranodal lesions (P <0.0001) (Kappa value = 0.632) and bone marrow (P <0.0001) (Kappa value = 0.728) compared to contrast enhanced CT and BMB. PET/CT had upstaged 15 cases (16%) and down-staged 4 cases (4.3%) (P <0.001) (Kappa value = 0.649). Among the upstaged 15 cases, 10 patients (10.9%) were upstaged from stage II to III, based on residual in PET/CT not seen in contrast enhanced CT after abdominal mass excision. Four patients (4.3%) were upstaged from stage III to IV based on bone marrow uptake in FDG-PET without positivity in BMA or BMB. Regarding response assessment, sensitivity was 60% for PET and 80% for contrast-enhanced CT (p=0.56). Specificity was 100% for PET and 65% for CT (p< 0.0001). Positive predictive value for PET was 100%, while was 12% for CT scan (p< 0.0001). Negative predictive value for both PET and CT was 98% (p= 0.82). Five patients had 2nd biopsy to confirm viability of the residual lesions, 4 lesions were negative in pathological examination (all of them were metabolic negative in PET/CT; Deauville score below 4). One lesion was positive in pathological examination (was positive in PET/CT; Deauville score of 4).

Conclusion: PET/CT detected additional sites compared with contrast-enhanced CT and resulted in changing stage of disease. PET scan is significantly more specific than CT in the management of children with Burkitt lymphoma.

Sana Nasir Bhalli

Jinnah Hospital

Title: Rare presentation of malaria: A sheep in a wolf s clothing
Speaker
Biography:

Dr.Sana is currently working as a Doctor in Jinnah Hospital, Pakistan.

Abstract:

Background

Malaria is an endemic disease in Pakistan. P.vivax (Plasmodium vivax) is considered to cause a milder form of infection, while P.falciparum (Plasmodium falciparum )and mixed infections are associated with severe thrombocytopenia and cutaneous lesions. Here we report a rare presentation of isolated P.vivax malaria, causing severe thrombocytopenia and skin manifestations. To the best of our knowledge this is the first ever case reported from Pakistan of profound thrombocytopenia with isolated P.vivax infection.

Case Report

 A 16-year old-female on treatment for idiopathic thrombocytopenic purpura (ITP) presented in emergency with complaints of epistaxis, gum bleeding and high grade fever for 3 days. Examination revealed fever (103° F), purpuric lesions on face, lips and petechial lesions on lower limbs (Fig1). Rest of the examination was unremarkable. There was no significant drug or family history. Labs showed Hb 11.2g/dl, TLC 7.3×109/l and platelet count 4×109/l. Peripheral smear revealed grossly reduced platelets with gametocytes of P.vivax (Fig.2). PT, APTT and INR were normal. Dengue, HIV and ANA serologies were negative. Chloroquine followed by primaquine was given along with tapering of prednisone. Fever and purpuric lesions settled. Platelet count showed an improving trend(Fig.3). Prednisone was stopped with regular follow ups. At 3 months her platelet count remained stable.

Discussion

Cases of isolated P.vivax malaria causing severe thrombocytopenia are rare. Above mentioned case is of P.vivax monoinfection causing severe thrombocytopenia and purpuric lesions. It Is pertinent to note that the patient was diagnosed and being treated for ITP before presenting to us. Hence physicians need to reevaluate the clinical spectrum of P. vivax presentation especially in the light of thrombocytopenia.

Conclusion

Isolated P.vivax infections can also cause severe thrombocytopenia along with bleeding manifestations. Therefore, it should not be missed in a differential diagnosis of severe thrombocytopenia especially in malaria endemic regions.